Mature sequence bmo-miR-307-3p

Accession numberMIMAT0004208
IDbmo-miR-307-3p
Previous IDsbmo-miR-307
Stem-Loop bmo-mir-307
Sequence
ucacaaccuccuugagugag
Get sequence
Deep sequencing59 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
4
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).