Mature sequence mmu-miR-802-5p

Accession numberMIMAT0004188
IDmmu-miR-802-5p
Previous IDsmmu-miR-802
Stem-Loop mmu-mir-802
Sequence
ucaguaacaaagauucauccuu
Get sequence
Deep sequencing1462 reads, 28 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).