Mature sequence osa-miR816

Accession numberMIMAT0004061
IDosa-miR816
Stem-Loop osa-MIR816
Sequence
gugacauauuuuacuacaac
Get sequence
Deep sequencing27 reads, 2 experiments
Database links
QuickGO function

References

1