Mature sequence osa-miR812d

Accession numberMIMAT0004052
IDosa-miR812d
Stem-Loop osa-MIR812d
Sequence
gacggacgguuaaacguuggac
Get sequence
Deep sequencing3769 reads, 2 experiments
Database links
QuickGO function

References

1