Mature sequence hsa-miR-769-3p

Accession numberMIMAT0003887
IDhsa-miR-769-3p
Stem-Loop hsa-mir-769
Sequence
cugggaucuccggggucuugguu
Get sequence
Deep sequencing3307 reads, 129 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).