Mature sequence hsa-miR-767-5p

Accession numberMIMAT0003882
IDhsa-miR-767-5p
Stem-Loop hsa-mir-767
Sequence
ugcaccaugguugucugagcaug
Get sequence
Deep sequencing2121 reads, 48 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).