Mature sequence hsa-miR-668-3p

Accession numberMIMAT0003881
IDhsa-miR-668-3p
Stem-Loop hsa-mir-668
Sequence
ugucacucggcucggcccacuac
Get sequence
Deep sequencing331 reads, 40 experiments
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).