Mature sequence bta-miR-545-5p

• Accession number: MIMAT0003806
• ID: bta-miR-545-5p
• Previous IDs: bta-miR-545*
• Stem-Loop: bta-mir-545
• Sequence: ucaguaaauguuuauuggaug
• Deep sequencing: 293 reads, 63 experiments
• Predicted targets:
  • TargetScanVert:bta-miR-545-5p

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2. PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).