Mature sequence bta-miR-215

• Accession number: MIMAT0003797
• ID: bta-miR-215
• Stem-Loop: bta-mir-215
• Sequence: augaccuaugaauugacagaca
• Deep sequencing: 13532276 reads, 78 experiments
• Predicted targets:
  • TargetScanVert:bta-miR-215

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).