Mature sequence bta-miR-193a-5p

Accession numberMIMAT0003794
IDbta-miR-193a-5p
Previous IDsbta-miR-193a*
Stem-Loop bta-mir-193a
Sequence
ugggucuuugcgggcgagauga
Get sequence
Deep sequencing6872 reads, 64 experiments
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).