Mature sequence dre-miR-740

Accession numberMIMAT0003771
IDdre-miR-740
Stem-Loop dre-mir-740
Sequence
auaaaaagugguaugguacagu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).