Mature sequence dre-miR-729

Accession numberMIMAT0003758
IDdre-miR-729
Stem-Loop dre-mir-729
Sequence
cauggguaugauacgaccuggguu
Get sequence
Deep sequencing58 reads, 8 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).