Mature sequence dre-miR-725-3p

Accession numberMIMAT0003753
IDdre-miR-725-3p
Previous IDsdre-miR-725
Stem-Loop dre-mir-725 dre-mir-725-2
Sequence
uucagucauuguuucuaguagu
Get sequence
Deep sequencing72068 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).