Mature sequence dre-miR-724

Accession numberMIMAT0003752
IDdre-miR-724
Stem-Loop dre-mir-724
Sequence
uuaaagggaauuugcgacuguu
Get sequence
Deep sequencing1885 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).