Mature sequence xtr-miR-100

Accession numberMIMAT0003682
IDxtr-miR-100
Stem-Loop xtr-mir-100
Sequence
aacccguagauccgaacuugug
Get sequence
Deep sequencing reads, experiments
Predicted targets

References