Mature sequence xtr-miR-24a-3p

Accession numberMIMAT0003654
IDxtr-miR-24a-3p
Previous IDsxtr-miR-24a
Stem-Loop xtr-mir-24a
Sequence
uggcucaguucagcaggaacag
Get sequence
Deep sequencing reads, experiments
Predicted targets

References