Mature sequence xtr-miR-24a-5p

Accession numberMIMAT0003653
IDxtr-miR-24a-5p
Previous IDsxtr-miR-189
Stem-Loop xtr-mir-24a
Sequence
gugccuacugaacugauaucagu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References