Mature sequence mmu-miR-719

Accession numberMIMAT0003465
IDmmu-miR-719
Stem-Loop mmu-mir-719
Sequence
aucucggcuacagaaaaauguu
Get sequence
Deep sequencing2 reads, 2 experiments
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).