Mature sequence gga-miR-9-3p

Accession numberMIMAT0003350
IDgga-miR-9-3p
Previous IDsgga-miR-9*
Stem-Loop gga-mir-9-1
Sequence
uaaagcuagagaaccgaaugu
Get sequence
Deep sequencing293426 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References