Mature sequence hsa-miR-659-3p

Accession numberMIMAT0003337
IDhsa-miR-659-3p
Previous IDshsa-miR-659
Stem-Loop hsa-mir-659
Sequence
cuugguucagggagggucccca
Get sequence
Deep sequencing43 reads, 33 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).