Mature sequence hsa-miR-657

Accession numberMIMAT0003335
IDhsa-miR-657
Stem-Loop hsa-mir-657
Sequence
ggcagguucucacccucucuagg
Get sequence
Deep sequencing6 reads, 5 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).