Mature sequence hsa-miR-634

Accession numberMIMAT0003304
IDhsa-miR-634
Stem-Loop hsa-mir-634
Sequence
aaccagcaccccaacuuuggac
Get sequence
Deep sequencing2 reads, 2 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).