Mature sequence hsa-miR-583

Accession numberMIMAT0003248
IDhsa-miR-583
Stem-Loop hsa-mir-583
Sequence
caaagaggaaggucccauuac
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).