Mature sequence hsa-miR-567

Accession numberMIMAT0003231
IDhsa-miR-567
Stem-Loop hsa-mir-567
Sequence
aguauguucuuccaggacagaac
Get sequence
Deep sequencing2120 reads, 9 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).