Mature sequence hsa-miR-562

Accession numberMIMAT0003226
IDhsa-miR-562
Stem-Loop hsa-mir-562
Sequence
aaaguagcuguaccauuugc
Get sequence
Deep sequencing7 reads, 5 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).