Mature sequence hsa-miR-557

Accession numberMIMAT0003221
IDhsa-miR-557
Stem-Loop hsa-mir-557
Sequence
guuugcacgggugggccuugucu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).