Mature sequence tni-miR-100

Accession numberMIMAT0003064
IDtni-miR-100
Stem-Loop tni-mir-100
Sequence
aacccguagauccgaacuugug
Get sequence
Deep sequencing reads, experiments

References