Mature sequence tni-miR-133

Accession numberMIMAT0003058
IDtni-miR-133
Stem-Loop tni-mir-133
Sequence
uuugguccccuucaaccagcug
Get sequence
Deep sequencing reads, experiments

References