Mature sequence fru-miR-133

Accession numberMIMAT0003057
IDfru-miR-133
Stem-Loop fru-mir-133
Sequence
uuugguccccuucaaccagcug
Get sequence
Deep sequencing reads, experiments

References