Mature sequence hsa-miR-532-5p

Accession numberMIMAT0002888
IDhsa-miR-532-5p
Previous IDshsa-miR-532
Stem-Loop hsa-mir-532
Sequence
caugccuugaguguaggaccgu
Get sequence
Deep sequencing114647 reads, 158 experiments
Database links
Predicted targets
QuickGO function

References

1
"PCR-based expression analysis and identification of microRNAs" Lu DP, Read RL, Humphreys DT, Battah FM, Martin DIK, Rasko JEJ RNAi and Gene Silencing 1:44-49(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).