Mature sequence osa-miR531a

Accession numberMIMAT0002887
IDosa-miR531a
Previous IDsosa-miR531
Stem-Loop osa-MIR531a
Sequence
cucgccggggcugcgugccgccau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:16126864 "Loss of function of OsDCL1 affects microRNA accumulation and causes developmental defects in rice" Liu B, Li P, Li X, Liu C, Cao S, Chu C, Cao X Plant Physiol. 139:296-305(2005).