Mature sequence osa-miR529a

• Accession number: MIMAT0002885
• ID: osa-miR529a
• Previous IDs: osa-miR529
• Stem-Loop: osa-MIR529a
• Sequence: cuguacccucucucuucuuc
• Deep sequencing: 6 reads, 2 experiments
• Database links:
  • RNAcentral:URS0000333CCD_39947

References

1. PMID:16126864 "Loss of function of OsDCL1 affects microRNA accumulation and causes developmental defects in rice" Liu B, Li P, Li X, Liu C, Cao S, Chu C, Cao X Plant Physiol. 139:296-305(2005).