Accession | MIMAT0002809 |
Description | hsa-miR-146b-5p mature miRNA |
Hairpins | |
Sequence | UGAGAACUGAAUUCCAUAGGCUG |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:16885212 | has_input UniProtKB:P51617 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26338965 | has_input UniProtKB:P05231 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28727754 | has_input UniProtKB:Q9H4E5 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30362152 | has_input UniProtKB:Q16552 |
involved_in | GO:0010719 negative regulation of epithelial to mesenchymal transition |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26338965 | |
involved_in | GO:0010764 negative regulation of fibroblast migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26338965 | |
involved_in | GO:0032700 negative regulation of interleukin-17 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30362152 | has_input UniProtKB:Q16552 |
involved_in | GO:0034121 regulation of toll-like receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:16885212 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:16885212 | has_input UniProtKB:P51617 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26338965 | has_input UniProtKB:P05231 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28727754 | has_input UniProtKB:Q9H4E5 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30362152 | has_input UniProtKB:Q16552 |
involved_in | GO:0071222 cellular response to lipopolysaccharide |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:16885212 | |
involved_in | GO:0090051 negative regulation of cell migration involved in sprouting angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28727754 | results_in_movement_of CL:0002619 |
involved_in | GO:0090272 negative regulation of fibroblast growth factor production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26338965 | |
located_in | GO:0005615 extracellular space |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|