Mature sequence hsa-miR-511-5p

• Accession number: MIMAT0002808
• ID: hsa-miR-511-5p
• Stem-Loop: hsa-mir-511
• Sequence: gugucuuuugcucugcaguca
• Deep sequencing: 327 reads, 82 experiments
• Predicted targets:
  • TargetScanVert:hsa-miR-511-5p
  • miRDB:hsa-miR-511-5p
  • microrna.org:hsa-miR-511-5p

References

1. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).