Mature sequence mne-miR-24-5p

Accession numberMIMAT0002340
IDmne-miR-24-5p
Previous IDsmne-miR-189;mne-miR-24*
Stem-Loop mne-mir-24-1
Sequence
gugccuacugagcugauaucagu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).