Mature sequence ptr-miR-133a

Accession numberMIMAT0002243
IDptr-miR-133a
Stem-Loop ptr-mir-133a-1 ptr-mir-133a-2
Sequence
uuugguccccuucaaccagcug
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).