Mature sequence ptc-miR395f

Accession numberMIMAT0002026
IDptc-miR395f
Stem-Loop ptc-MIR395f
Sequence
cugaaguguuugggggaacuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).