Mature sequence ptc-miR394b-5p

Accession numberMIMAT0002020
IDptc-miR394b-5p
Previous IDsptc-miR394b
Stem-Loop ptc-MIR394b
Sequence
uuggcauucuguccaccucc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).
2
PMID:18363789 "Stress-responsive microRNAs in Populus" Lu S, Sun YH, Chiang VL Plant J. 55:131-151(2008).