Mature sequence ptc-miR393c

Accession numberMIMAT0002017
IDptc-miR393c
Stem-Loop ptc-MIR393c
Sequence
uccaaagggaucgcauugauc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).