Mature sequence ptc-miR159d

Accession numberMIMAT0001904
IDptc-miR159d
Stem-Loop ptc-MIR159d
Sequence
cuuggauugaagggagcuccu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).