Mature sequence dre-miR-454b

Accession numberMIMAT0001878
IDdre-miR-454b
Stem-Loop dre-mir-454b
Sequence
uagugcaauauugcuuauaggg
Get sequence
Deep sequencing25128 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).