Mature sequence dre-miR-375

Accession numberMIMAT0001876
IDdre-miR-375
Stem-Loop dre-mir-375-1 dre-mir-375-2
Sequence
uuuguucguucggcucgcguua
Get sequence
Deep sequencing31929 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).