Mature sequence dre-miR-142a-5p

Accession numberMIMAT0001838
IDdre-miR-142a-5p
Stem-Loop dre-mir-142a
Sequence
cauaaaguagaaagcacuacu
Get sequence
Deep sequencing10525 reads, 10 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).