Mature sequence dre-miR-126a-3p

Accession numberMIMAT0001823
IDdre-miR-126a-3p
Previous IDsdre-miR-126;dre-miR-126a
Stem-Loop dre-mir-126a
Sequence
ucguaccgugaguaauaaugc
Get sequence
Deep sequencing14405 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).