Mature sequence dre-miR-103

Accession numberMIMAT0001816
IDdre-miR-103
Stem-Loop dre-mir-103
Sequence
agcagcauuguacagggcuauga
Get sequence
Deep sequencing29289 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).