Mature sequence dre-miR-16b

Accession numberMIMAT0001775
IDdre-miR-16b
Stem-Loop dre-mir-16b
Sequence
uagcagcacguaaauauuggag
Get sequence
Deep sequencing24207 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).