Mature sequence sbi-miR156e

Accession numberMIMAT0001758
IDsbi-miR156e
Stem-Loop sbi-MIR156e
Sequence
ugacagaagagagcgagcac
Get sequence
Deep sequencing reads, experiments

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).