Mature sequence zma-miR399c-3p

Accession numberMIMAT0001705
IDzma-miR399c-3p
Previous IDszma-miR399c
Stem-Loop zma-MIR399c
Sequence
ugccaaaggagaauugcccug
Get sequence
Deep sequencing623 reads, 6 experiments

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).