Mature sequence mtr-miR399c

Accession numberMIMAT0001650
IDmtr-miR399c
Stem-Loop mtr-MIR399c
Sequence
ugccaaaggagauuugcccug
Get sequence
Deep sequencing reads, experiments

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).