Mature sequence dre-miR-451

Accession numberMIMAT0001634
IDdre-miR-451
Stem-Loop dre-mir-451
Sequence
aaaccguuaccauuacugaguu
Get sequence
Deep sequencing8087 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).